Gelpicture

Go back to top

GELPICTURE

GELPICTURE

FUNCTION

GelPicture reads a contig from the Fragment Assembly database and displays a diagram of the gel alignments and a printout of the aligned gel sequences and consensus. GelPicture has been modified to include the sequence direction in both sections of the output, and to mark with '=======' any consensus sequence that is correct (agrees with every fragment) and has been sequenced in both directions.

DESCRIPTION

GelPicture produces an output file which contains the "picture" of the fragments in a contig, and a "pretty" display of the fragment sequence alignment.

If GelPicture is given a list of primer sequences, it can also display the location and direction of the primers found in the contig.

The output from GelPicture can be printed, and used to check differences between aligned fragments. Where the consensus sequence does not agree with every fragment in the contig, the consensus sequence is highlighted. The raw data at these base positions can then be checked and corrected so that all fragments agree with the consensus.

AUTHOR

This program was written by Peter Rice (E-mail: pmr@sanger.ac.uk Post: Informatics Division, The Sanger Centre, Hinxton Hall, Cambridge, CB10 1RQ, UK).

All EGCG programs are supported by the EGCG Support Team, who can be contacted by E-mail (egcg@embnet.org).

EXAMPLE

Here is a sample session with GelPicture

  
  
  % gelpicture
  
    GelPicture of which contig ?  mu27
  
    What should I call the output file (* mu27.pic *) ?
  
  %

OUTPUT

The output file from GelPicture is in two parts. The first page shows a diagram of the fragment alignment, similar to the bottom part of the GelAssemble screen. The following pages show the actual sequences. Base positions in the consensus which agree with every fragment are not shown; other positions are highlighted by printing the base on the consensus line.

The fragment numbers reported by GelPicture are the same as those used by GelAssemble.

  
  
  GelPicture of project Testfa contig Mu27,              April 4, 1991  10:28
  
  ( 8)     Mu26b +                           ---+----+----+--->
  ( 7)      Mu32 -                        <+--
  ( 6)      Mu18 -                       <-+--
  ( 5)       Mu9 +                       --+->
  ( 4)      Mu26 +                       --+->
  ( 3)     Mu18b -   <-+----+----+----+---
  ( 2)      Mu27 + ----+----+----+----+----+---->
  ( 1) Consensus   ----+----+----+----+----+----+----+----+--->
                    ....+....+....+....+....+....+....+....+....+....+
              1                                              500
  
  Pretty of project Testfa contig Mu27,                 April 4, 1991  10:28
  
  (  3)     Mu18b -  205                        TAGCTATATTAATCACTTGCGTACCAC  179
  (  2)      Mu27 +    1 AAAAAAAAAATCGTTATTTGGCGTGACTATATTAATCACTTGCGTACCAC   50
  (  1) Consensus      1 ---------+---------+---=rr===+=========+=========+   50
                                       >********************>
                                       prim2
                                       (assume GA is correct)
  
       ////////////////////////////////////////////////////////////
  
  
  (  8)     Mu26b +  137 CCATGTTGTTTTACTTGACCATATCTAAAAAAAAAAA               173
  (  1) Consensus    401 ---------+---------+---------+-------               437

RELATED PROGRAMS

The GCG Fragment Assembly System programs are used to enter and manipulate raw sequence data. GelStatus reads a GCG Fragment Assembly database, and produces a summary report of the quality of each contig. GelAnalyze reads a GelStatus report from a shotgun project, and produces project statistics by the method of Lander and Waterman.

RESTRICTIONS

The GCG Fragment Assembly System must be already started (by running GelStart) before GelPicture can be used.

CONSIDERATIONS

GelPicture displays the fragment names on the left of the picture and of the sequence alignment. If the fragment name is longer than 11 characters, GelPicture will only display the last 11 characters.

SUGGESTIONS

GelPicture should be run frequently to allow a manual check on the quality of the raw data. Sequencing problems can often be detected by looking for common differences in the whole sequence alignment of a contig.

DEVICES REQUIRED

The output file from GelPicture is 80 characters wide, and can be printed on any printer.

INPUT FILE

The input to GelPicture is a contig from the GCG Fragment Assembly System .

Primer sequences are supplied to GelPicture in the same format as the pattern input file for the Find program in GCG. The primer file is used when the "-Primer=filename" option is put on the command line. The default file name is primers.dat.

The primer sequence must appear (possibly with gaps) in either the consensus or one of the fragments.

This is an example of a primer data file suitable for GelPicture

  
  
  
  Example primer database for GelPicture
  =======================================
  
  Everything up to the two dots is a comment
  Primer, Primer sequence, and Comments are printed by GelPicture
  The format is the same as for pattern input to the GCG FIND program
  Everything is separated by spaces or tabs, exact column positions do not matter
  
  Primer    Zero  Primer sequence         Dot "!" Comments
  ------    ----  -------------------     --- --- --------------------    ..
  ! Lines starting with '!' are comments
  prim1      0    atgatgcatcgggcacgat      .  !  first attempt
  prim2      0    ggcgtgactatattaatcactt   .  !  assume GA is correct

COMMAND-LINE SUMMARY

All parameters for this program may be put on the command line. Use the option -CHEck to see the summary below and to have a chance to add things to the command line before the program executes. In the summary below, the capitalized letters in the qualifier names are the letters that you must type in order to use the parameter. Square brackets ([ and ]) enclose qualifiers or parameter values that are optional. For more information, see "Using Program Parameters" in Chapter 3, Basic Concepts: Using Programs in the GCG User's Guide.

  
  
  Minimum syntax: % gelpicture [-CONTig=]c001uaaa -Default
  
  Optional Parameters:
  
  -OUTfile=c001uaaa.Pic   Output file
  -PRIMers=Primers.Dat    Output file
  -WIDth=50               Width of output (in bases)
  -NOUPper                Treat lower case as ambiguous
  -NOPICture              Don't print diagram
  -NOPRETty               Don't print sequence