Prima

Go back to top

PRIMA*(+)


FUNCTION

Prima selects oligonucleotide primers for a template DNA sequence. The primers may be useful for the polymerase chain reaction (PCR) or for DNA sequencing. You can allow Prima to choose primers from the whole template or limit the choices to a particular set of primers listed in a file.

The Polymerase Chain Reaction (PCR) process for amplifying nucleic acids is covered by U.S. Patent Nos. 4,683,195 and 4,683,202 owned by Hoffmann La Roche. A license for research may be obtained through the purchase and use of authorized reagents and thermocyclers from Perkin-Elmer Corp., or by otherwise negotiating a license with Perkin-Elmer. No license to use PCR is granted by the purchase or use of the Wisconsin Package(TM) or by the use of the EGCG extensions to GCG.


DESCRIPTION

Prima analyzes a template DNA sequence and chooses primer pairs for the polymerase chain reaction (PCR) and primers for DNA sequencing. For PCR primer pair selection, you can choose a target range of the template sequence to be amplified. For DNA sequencing primers, you can specify positions on the template that must be included in the sequencing.

In selecting appropriate primers, Prima considers a variety of constraints on the primer and amplified product sequences. You either can use the program's default constraint values or modify those values to customize the analysis. You can specify upper and lower limits for primer and product melting temperatures and for primer and product GC contents. For primers, you can specify a range of acceptable primer sizes, any required bases at the 3' end of the primer (3' clamp), and a maximum difference in primer melting temperatures for PCR primer pairs. For PCR products, you can specify a range of acceptable product sizes.

For efficient priming, you should avoid primers with extensive self-complementarity in order to minimize primer secondary structure and primer dimer formation. Additionally, in PCR experiments, primer pairs with extensive complementarity between the two primers should be avoided in order to minimize primer dimer formation. Prima uses the annealing test described in the ALGORITHM topic to check individual primers for self-complementarity and to check the two primers in a PCR primer pair for complementarity to each other. Using this same annealing test, Prima optionally can screen against non-specific primer binding on the template sequence and on any repeated sequences you specify.

The terms forward primer and reverse primer are used in the remainder of this document and in the program output. Forward primers are complementary to sequences on the reverse template strand and create copies of the forward strand by primer extension. Conversely, reverse primers are complementary to sequences on the forward template strand and create copies of the reverse strand by primer extension.

The name Prima is a truly European one. In searching for yet another primer program name, we doscovered that not only can Prima be pronounced in English as "Primer", but it has additional meanings in other languages. In Italian it means "first", in German it means "super", and in Spanish it means "cousin", reflecting the way it is related to GCG's Prime.


AUTHOR

This GCG program was modified by Peter Rice (E-mail: pmr@sanger.ac.uk Post: Informatics Division, The Sanger Centre, Hinxton Hall, Cambridge, CB10 1RQ, UK).

All EGCG programs are supported by the EGCG Support Team, who can be contacted by E-mail (egcg@embnet.org).


EXAMPLE

Here is a session using Prima to select PCR primers to amplify a 100 to 300 base portion of a human globin DNA sequence.

  
  
  % prima
  
   PRIMA uses nucleotide sequence data
  
   PRIMA of what sequence ?  ggamma.seq
  
               Start (* 1 *) ?
             End (*  1700 *) ? 500
  
   Minimum primer length (* 18 *) ?
   Maximum primer length (* 22 *) ?
  
   Minimum product length (* 100 *) ?
   Maximum product length (* 300 *) ?
  
   What should I call the output file name (* ggamma.prima *) ?
  
   This program can display the primer binding sites graphically.
   Do you want to:
  
  A) Plot to a FIGURE file called "prima.figure"
  B) Plot graphics on LaserWriter attached to /dev/tty10
  C) Suppress the plot
  
   Please choose one (* A *):
  
  
   Searching for forward primers
      ..........................................
  
   Searching for reverse primers
      .........................................
  
   Selecting primer pairs
      .............................................................
      .............................................................
      .................................................
   FIGURE instructions are now being written into prima.figure.
  
   ////////////////////////////////////////////////////////////////
  
      Output file: ggamma.prima
  
         CPU time: 5.78 seconds
  
  %
  


OUTPUT

Text File Output

Here is some of the output file listing the twenty-five most appropriate PCR primer pairs selected by Prime.

  
  
  
  PRIMA of: ggamma.seq  ck: 3814  from: 1 to: 500  May 15, 1994 15:24
  
                              INPUT SUMMARY
                              -------------
  
 Input sequence: ggamma.seq
  
   Primer constraints:
 primer size: 18 - 22
 primer 3' clamp: S
 primer sequence ambiguity: NOT ALLOWED
 primer GC content: 40.0 - 55.0%
 primer Tm: 50.0 - 65.0 degrees Celsius
 primer self-annealing. . .
    3' end: <   8.0    (weight:  2.0)
     total: <  14.0    (weight:  1.0)
 unique primer binding sites: required
 primer-template and primer-repeat annealing. . .
    3' end: ignored
     total: ignored
 repeated sequences screened: none specified
  
   Product constraints:
 product length: 100 - 300
 product GC content: 40.0 - 55.0
 product Tm: 70.0 - 95.0 degrees Celsius
 duplicate primer endpoints: NOT ALLOWED
 difference in primer Tm: < 2.0 degrees Celsius
 primer-primer annealing. . .
    3' end: <   8.0    (weight:  2.0)
     total: <  14.0    (weight:  1.0)
  
                                        PRIMER SUMMARY
                                        --------------
  
                                  forward            reverse
  
   Number of primers considered:          1387               1386
  
   Number of primers rejected for . . .
            primer 3' clamp:          227                225
  primer sequence ambiguity:            0                  0
          primer GC content:          623                633
                  primer Tm:           67                 72
   non-unique binding sites:            0                  0
      primer self-annealing:           54                 52
  primer-template annealing:            0                  0
    primer-repeat annealing:            0                  0
  
   Number of primers accepted:             416                404
  
                                       PRODUCT SUMMARY
                                       ---------------
  
   Number of products considered:                168064
  
   Number of producted rejected for. . .
             product length:                124863
         product GC content:                  1353
                 product Tm:                     0
           product position:                     0
 duplicate primer endpoints:                 15263
    difference in primer Tm:                 17410
    primer-primer annealing:                  7465
  
   Number of products accepted:                    1710
 Number of products saved:                      25
  
  --------------------------------------------------------------------
  
   Product: 1
  
   [DNA] = 50.000 nM   [salt] = 50.000 mM
  
                                PRIMERS
                                -------
  
                                     5'                3'
     forward primer (19-mer):     13 TCAGCAGTTCCACACACTC 31
     reverse primer (18-mer):    152 CCAGCATCTTCCACATTC  135
  
  
                                  forward            reverse
  
                 primer %GC:         52.6               50.0
primer Tm (degrees Celsius):         55.5               54.8
  
  
                                PRODUCT
                                -------
  
             product length:  140
                product %GC: 51.4
                 product Tm: 77.0 degrees Celsius
    difference in primer Tm:  0.8 degrees Celsius
            annealing score: 37.0
  
   optimal annealing temperature: 55.4 degrees Celsius
  
  --------------------------------------------------------------------
  
   Product: 2
  
   [DNA] = 50.000 nM   [salt] = 50.000 mM
  
                                PRIMERS
                                -------
  
                                     5'                3'
     forward primer (19-mer):     13 TCAGCAGTTCCACACACTC 31
     reverse primer (19-mer):    151 CAGCATCTTCCACATTCAC 133
  
   //////////////////////////////////////////////////////////////
  

The output file begins with a summary listing all of the constraints used by the program to select appropriate primers or PCR primer pairs. Most of these constraints can be modified by adjusting prompted and optional program parameters. Many of these constraints were described in the DESCRIPTION topic of this document. Several of the constraints, including primer-self annealing, primer-template annealing, primer-primer annealing, and duplicate primer endpoints, are explained more fully in the ALGORITHM and CONSIDERATIONS topics.

Following the input summary, a primer summary lists the number of forward and reverse primers considered by Prima and the number of primers rejected because they failed to meet the various primer constraints. You can use this information to relax the appropriate program constraints if few or no primers are accepted.

If you are selecting PCR primer pairs, the primer summary is followed by a product summary listing the number of PCR products considered by Prima and the number of products rejected because they failed to meet the various product constraints. Again, you can use this information to relax the appropriate program constraints if few or no PCR primer pairs are selected.

Following these summaries is an ordered listing of the most appropriate primers or PCR primer pairs selected by Prima The list is ordered by total annealing score (see the ALGORITHM topic) so that those primers or PCR primer pairs with the least amount of complementarity to sequences other than the appropriate primer binding sites are listed first. Each output primer or PCR primer pair is designated by a number that corresponds to a line number in the plot of primer sites. While the text output file lists the location of the primer binding site along with each primer sequence, the plot provides a convenient way to review the primer binding sites of many of the selected primers at once.

Primer Sites Plot

Prima can create a plot of the primer sites that can help you rapidly review the primer binding sites for the primers selected by the program. The line numbers in the plot correspond to the primer or product numbers in the text output file. Short blue lines extending above the horizontal sequence line indicate the positions of forward primers and short red lines extending below the sequence line indicate the positions of reverse primers.

By default, Prima writes instructions for plotting the primer sites into a figure file named prima.figure. Such files can be plotted on any supported graphics device using the Figure program.

This is the plot from the example session


RELATED PROGRAMS

The GCG mapping programs Map, MapPlot, and MapSort can be used to mark finds in the context of a DNA restriction map. FindPatterns identifies sequences that contain short patterns like GAATTC or YRYRYRYR. You can define the patterns ambiguously and allow mismatches. You can provide the patterns in a file or simply type them in from the terminal.


RESTRICTIONS

The segment of the input sequence used in the search for primers may not be longer than 32,000 bases. You cannot search for primers longer than fifty bases. You cannot specify a maximum product length greater than 10,000 bases. Prima will not read more than 5,000 primers from an input file of primer sequences.


ALGORITHM

Thermodynamic Calculations

Prima determines primer melting temperatures by a calculation using the nearest-neighbor model of Borer, et al. (J. Mol. Biol. 86; 843-853 (1974)) as modified slightly by Rychlik, et al. (Nucleic Acids Res. 18; 6409-6412 (1990)) and the thermodynamic parameters for DNA nearest-neighbor interactions determined by Breslauer, et al. (Proc. Natl. Acad. Sci. USA. 83; 3746-3750 (1986)):

  
  T(m)primer) = delta H / (delta S + R x ln(c/4) - 273.15 + 16.6 x log[K(+)]
  

where delta H is the enthalpy of helix formation, delta S is the entropy of helix formation (including helix initiation), R is the molar gas constant (1.987 cal/degree Celsius/mol), and c is the primer concentration.

Prima determines PCR product melting temperatures using the formula of Baldino, et al. (in Methods Enzymol. 168; 761-777 (1989)) as modified slightly by Rychlik, et al. (Nucleic Acids Res. 18; 6409-6412 (1990)).

  
  T(m)product) = 0.41 x (% G+C) + 16.6 x log[K(+)] - 675 / len + 81.5
  

where len is the length of the product.

If you are selecting PCR primer pairs, the output includes a proposed annealing temperature for each listed primer pair. The annealing temperature is calculated using the formula of Rychlik, et al. (Nucleic Acids Res. 18; 6409-6412 (1990)).

  
  T(a) = 0.3 x T(m)primer) + 0.7 x T(m)product) - 14.9
  

Annealing Tests

Prima uses an annealing test described by Hillier and Green (PCR Methods and Applications. 1; 124-128 (1991)), with slight modification, to check individual primers for self-complementarity and to check the two primers in a PCR primer pair for complementarity to each other. For tests of self-complementarity, a primer sequence in the 5' to 3' orientation is compared with the same sequence in the 3' to 5' orientation. For tests of complementarity between two different primers, one of the primer sequences in the 5' to 3' orientation is compared to the other sequence in the 3' to 5' orientation. The sequences are compared in every register of comparison, using a scoring matrix containing values of complementarity for every pair of nucleotide symbols. (See the LOCAL DATA FILES topic for more information on the scoring matrix.) For each register of comparison, the score of each base pair comparison is determined. The scores of contiguous base pairs with positive comparison values are summed. The maximum score of all such contiguous segments, taken over all registers of comparison between the sequences, determines the total primer-primer annealing score. Complementarity at the 3' ends of the primer sequences has a particularly large influence on primer-dimer formation. Therefore, the maximum score of all contiguous segments that include the 3' position of either primer sequence, taken over all registers of comparison, is separately determined as the 3' primer-primer annealing score.

The same annealing test is used to determine complementarity between the primer and any non-specific binding sites on the template sequences. In this case, the primer in the 5' to 3' orientation is compared over all registers of comparison with the template sequence in the 3' to 5' orientation to determine a total primer-template annealing score. Since complementarity at the 3' end of the primer sequence has a particularly large effect on non-specific primer binding, the 3' primer-template annealing score is also determined. If you screen against non-specific primer binding on any specified repeated sequences, then total primer-repeat and 3' primer-repeat annealing scores, taken over all registers of comparison in all repeated sequences, are also determined.

Total and 3' annealing scores are saved in tests of primer self-complementarity (to check for secondary structure and primer dimer formation) and in tests of complementarity between the two primers in PCR primer pairs (to check for primer dimer formation). Total and 3' annealing scores are also saved when you screen against non-specific primer binding on the template sequence and when you screen against non-specific primer binding on any specified repeated sequences. Primers are rejected that exceed the maximum score you specify for any of these tests. For those primers that are accepted, the program uses the sum of all annealing scores to determine the order of primers or PCR primer pairs in the output list. You can specify weights for each of these scores to adjust their relative contributions in determining the output order. By default, 3' annealing scores have twice the weight of total annealing scores in determining the output order.


CONSIDERATIONS

The template sequence may contain ambiguous bases, but Prima will not select primers complementary to any ambiguous sites on the template sequence.

By default, primer selects appropriate PCR primer pairs. To search for DNA sequencing primers, you need to use either the -FORwardprimers or -REVerseprimers command-line qualifiers.

When several acceptable PCR primer pairs have the same 3' ends for both primers, Prima outputs only the PCR primer pair with the shortest primer sequences. By not allowing duplicate primer endpoints, Prima increases the diversity among the PCR primer pairs in the output list.

Prima only determines melting temperatures for DNA primers. We do not know of any appropriate nearest-neighbor thermodynamic parameters for RNA-DNA hybrids, so we haven't attempted to calculate melting temperatures for RNA primers. While thermodynamic parameters for RNA duplexes involving mismatches have been described, we do not know of any similar results for DNA duplexes. Therefore, we have not attempted to calculate melting temperatures or other thermodynamic properties for DNA duplexes involving mismatches.

Prima does not currently allow you to determine the compatibility of two primers for PCR in the absence of a template sequence. This function will be added in a future release.

Prima does not currently consider formamide concentration in determining primer melting temperatures.


SUGGESTIONS

If Prima fails to select any appropriate primers or PCR primer pairs, review the program summary displayed both on the terminal screen and in the output file. This summary lists the number of primers and PCR primer pairs rejected because they failed to meet each program constraint. With this information, you can determine which constraints to relax in subsequent runs of the Prima program.


GRAPHICS

The Wisconsin Package must be configured for graphics before you run any program with graphics output! If the % setplot command is available in your installation, this is the easiest way to establish your graphics configuration, but you can also use commands like % postscript that correspond to the graphics languages the Wisconsin Package supports. See Chapter 5, Using Graphics in the User's Guide for more information about configuring your process for graphics.


CTRL-C

If you need to stop this program, use C to reset your terminal and session as gracefully as possible. Searches and comparisons write out the results from the part of the search that is complete when you use C. The graphics device should stop plotting the current page and start plotting the next page. If the current page is the last page, plotters should put the pen away and graphic terminals should return to interactive mode.


INPUT FILE

Prima accepts any nucleotide sequence as input and selects appropriate oligonucleotide primers that are complementary to sites on the input template sequence.

You optionally can specify an input file of primer sequences from which to select appropriate oligonucleotide primers that are complementary to sites on the template sequence. The file of primer sequences for Prima is modeled on the enzyme data files for the mapping programs described in the Data Files manual. The primer names should not have more than 31 characters. The offset field is ignored by Prima but the field must have a number in it to make the input primer files compatible with the files that are read by mapping programs. The input primer sequence may contain only valid GCG sequence symbols (see Appendix III of this manual) and the single quotation mark ( ' ) and underscore ( _ ) characters. Single quotation marks and underscores in the sequence patterns are ignored. Prima ignores input primers containing any other characters in the sequence. The overhang field has no significance to Prima and can be omitted. For other GCG mapping programs, if the overhand field is absent or is a non-numeric character, then the bottom strand is not searched.

The exact spacing between each field does not matter, only the order of the fields in the line. Blank lines and lines that start with an exclamation point ("!") are ignored. Here is part of an example file of input primers:

  
  
  An example file of input primers for the PRIMA program.
  
  Name      Offset   Sequence                Documentation  ..
  
  x13598         1   ACCCTTCAGCAGTTCCACAC    !
  x24332         1   AAGCACCCTTCAGCAGTTCC    !
  u35982         1   AAGAGAGGTGGAAATGAGG     !
  

Slightom et al. (Biotechniques, in press (1994)) have shown that a small set of the 262,144 potential 9-mers appear in a large number of sequences and prime selectively enough to reduce the custom-primer costs that are usually associated with primer-walking sequence strategies.

The 9-mers identified by Slightom et al. are available as a kit from Genosys Biotechnologies, Inc., 1442 Lake Front Circle, Suite 185, The Woodlands, Texas, USA 77380, telephone (800) 234-5362. These 9-mer sequences are provided in a file, genosys.dat, that can be used as an input primer file for Prima To select appropriate primers from among these 9-mers, copy the file genosys.dat into your local directory with Fetch and then use the command-line option -PRImers= genosys.dat.


SEQUENCE TYPE

Prima only accepts nucleotide sequences. If Prima rejects your nucleotide sequence, turn to Appendix VI to see how to change or set the type of a sequence.


COMMAND-LINE SUMMARY

All parameters for this program may be put on the command line. Use the option -CHEck to see the summary below and to have a chance to add things to the command line before the program executes. In the summary below, the capitalized letters in the qualifier names are the letters that you must type in order to use the parameter. Square brackets ([ and ]) enclose qualifiers or parameter values that are optional. For more information, see "Using Program Parameters" in Chapter 3, Basic Concepts: Using Programs in the GCG User's Guide.

  
  
  Minimal Syntax: % prima [-INfile=]ggamma.seq -Default
  
  Prompted Parameters:
  
  -BEGin1=1 -END1=1700       range of interest
  -MINPROduct=100            minimum PCR product length
  -MAXPROduct=300            maximum PCR product length
  -MINPRImer=18              minimum primer length
  -MAXPRImer=22              maximum primer length
  [-OUTfile1=]ggamma.prime   output file name
  
  Local Data Files:
  
  -DATa1=prime.cmp     scoring matrix for annealing tests
  -DATa2=dnastack.ds   entropies for DNA melting temperature determination
  -DATa3=dnastack.dh   enthalpies for DNA melting temperature determination
  
  Optional Parameters:
  
  -LIStsize=25             maximum number of output primers or PCR
                        products shown
  -BEGin2=500 -END2=750    target range for PCR amplification
  -INClude=60.0            minimum % of specified PCR target range
                        range to be included in PCR products
  -FORwardprimers          select forward primers, only
  -REVerseprimers          select reverse primers, only
  -NOPROducts              suppress selection of PCR products
  -NOUNIque                permit duplicate primer binding sites on template
  -PRImers=myfile.dat      input file of primers to consider
  -REPeats=@mylist.list    repeated sequences to check for false priming
  -DNAconcentration=50.0   primer DNA concentration (nM)
  -SALtconcentration=50.0  salt concentration (mM)
  -CLAmp=S                 specify primer 3' clamp (using IUB ambiguity codes)
  -GCMINPRImer=40.0        minimum primer % G+C
  -GCMAXPRImer=55.0        maximum primer % G+C
  -TMMINPRImer=50.0        minimum primer melting temperature (Celsius)
  -TMMAXPRImer=65.0        maximum primer melting temperature (Celsius)
  -ENDANNEALPrimer=8.0     maximum primer-primer 3' annealing score
  -ENDWGTPrimer=2.0        relative weight of primer-primer 3' annealing
                        score
  -ALLANNEALPrimer=14.0    maximum primer-primer annealing score
  -ALLWGTPrimer=1.0        relative weight of primer-primer annealing
                        score
  -GCMINPROduct=40.0       minimum product % G+C
  -GCMAXPROduct=55.0       maximum product % G+C
  -TMMINPROduct=50.0       minimum product melting temperature (Celsius)
  -TMMAXPROduct=65.0       maximum product melting temperature (Celsius)
  -TMDIFference=2.0        maximum difference between melting temperatures
                        of two primers in PCR
  -ENDANNEALTemplate=16.0  maximum primer-template 3' annealing score
                        (primer-template annealing is ignored by default)
  -ENDWGTTemplate=0.5      relative weight of primer-template 3' annealing
                        score
  -ALLANNEALTemplate=28.0  maximum primer-template annealing score
                        primer-template annealing is ignored by default)
  -ALLWGTTemplate=0.25     relative weight of primer-template annealing
                        score
  
  -DENsity=1700            number of bases per 100 platen units in the plot
  -SPAcing=1.6             number of platen units per line in the plot
  -NOPLOt                  suppresses plot of primer sites
  -NOMONitor               suppresses screen trace of program progress
  -NOSUMmary               suppresses screen summary at the end of the program
  -BATch                   submits program to the batch queue
  
  All GCG graphics programs accept these and other switches. See the Using
  Graphics chapter of the USERS GUIDE for descriptions.
  
  -FIGure[=FileName]  stores plot in a file for later input to FIGURE
  -FONT=3             draws all text on the plot using font 3
  -COLor=1            draws entire plot with pen in stall 1
  -SCAle=1.2          enlarges the plot by 20 percent (zoom in)
  -XPAN=10.0          moves plot to the right 10 platen units (pan right)
  -YPAN=10.0          moves plot up 10 platen units (pan up)
  -PORtrait           rotates plot 90 degrees
  
  
  
  


LOCAL DATA FILES

The files described below supply auxiliary data to this program. The program automatically reads them from a public data directory unless you either 1) have a data file with exactly the same name in your current working directory; or 2) name a file on the command line with an expression like -DATa1=myfile.dat. For more information see Chapter 4, Using Data Files in the User's Guide.

Prima reads a scoring matrix from your local directory or the public database to use in the annealing tests that test for primer secondary structure, primer dimer formation, and false priming sites on the template and repeated sequence. The file prime.cmp assigns G-C, A-T, and G-T base pairs values of 3, 2, and 1, respectively, with all other pairs valued at 0.

Prima reads the files dnastack.ds and dnastack.dh for the DNA stacking entropies and enthalpies, respectively, used to calculate oligonucleotide primer melting temperatures.


OPTIONAL PARAMETERS

The parameters and switches listed below can be set from the command line. For more information, see "Using Program Parameters" in Chapter 3, Basic Concepts: Using Programs in the User's Guide.

-LIStsize=25

sets the maximum number of primers or PCR primer pairs you want to save in the output file. By default, 25 primers or PCR primer pairs are saved in the output file. If you choose primers from both strands of the template sequence but suppress the selection of PCR products with the -NOPROducts command-line qualifier, then the maximum number of output primers is saved for each strand of the template sequence. In this case, forward primers are listed before the reverse primers in the output file.

-BEGin2=500 -END2=750

sets the target range of the template sequence to be amplified using PCR. Unless you specify that only a portion of the target range must be amplified with the -INClude command-line qualifier, the program will choose primer pairs that amplify the entire target range of the template sequence.

If you are not choosing primers for PCR amplification experiments (by specifying any one of the -FORwardprimers, -REVerseprimers, or -NOPROducts command-line qualifiers), then you can specify parts of the template sequence that must be included in primer extension experiments (like DNA sequencing) with the appropriate use of the -BEGin2 and -END2 qualifiers. If you specify a position with the -BEGin2 qualifier, then all forward primer extensions must include that position. If you specify a position with the -END2 qualifier, then all reverse primer extensions must include that position.

-INClude=60.0

tells the program to choose primer pairs that amplify at least 60% of the target range specified with the -BEGin2 and -END2 command-line qualifiers. By default, primer pairs are chosen that amplify the entire specified target range.

-FORwardprimers

tells the program to select forward primers only. Forward primers bind to sequences on the reverse template strand and create copies of the forward strand by primer extension.

-REVerseprimers

tells the program to select reverse primers only. Reverse primers bind to sequences on the forward template strand and create copies of the reverse strand by primer extension.

-NOPROducts

suppresses the selection of primer pairs for PCR amplification experiments. Both forward and reverse primers are selected, but they are not tested in pair combinations to determine if they meet the PCR product constraints. The best forward and reverse primers selected are reported in the output file.

-NOUNIque

permits selection of primers that are complementary, without mismatch, to more than one site on the template sequence. By default, primers are selected that have single primer binding sites on the template sequence. (For more control over primer binding on the template sequence, use the -ALLANNEALTemplate and -ENDANNEALTemplate command-line qualifiers.)

-PRImers=myfile.dat

specifies an input file of primer sequences from which to select appropriate oligonucleotide primers that bind to the template sequence and meet all primer and product constraints.

-REPeats=@mylist.list

specifies an input list of repeated sequences to check for false priming sites with putative primer sequences. You can specify any valid GCG sequence specification. Primers are rejected that are complementary, without mismatch, to any repeated sequence for a length equal to the minimum acceptable primer length. (For more stringent control over primer binding on repeated sequences, use the -ALLANNEALTemplate and -ENDANNEALTemplate command-line qualifiers.)

-DNAconcentration=50.0

specifies the nM concentration of primer DNA in the reaction. This value is used in the calculation of primer melting temperature.

-SALtconcentration=50.0

specifies the mM salt concentration in the reaction. This value is used in the calculation of both primer and PCR product melting temperatures.

-CLAmp=S

specifies the required 3'-terminal bases (3' clamp) for the primer. Any number of 3'-terminal bases can be specified, and all IUB nucleotide ambiguity symbols (described in Appendix III of the Program Manual) may be used. For example, -CLAmp= WSS requires all selected primers to end in the three-base sequence that has an A or T, followed by a G or C, then terminated by another G or C. By default, the program requires a G or C as the 3'-terminal base of all selected primers.

-GCMINPRImer=40.0

sets the minimum acceptable % G+C for oligonucleotide primers.

-GCMAXPRImer=55.0

sets the maximum acceptable % G+C for oligonucleotide primers.

-TMMINPRImer=50.0

sets the minimum acceptable melting temperature (in degrees Celsius) for oligonucleotide primers.

-TMMAXPRImer=65.0

sets the maximum acceptable melting temperature (in degrees Celsius) for oligonucleotide primers.

-ENDANNEALPrimer=8.0

sets the maximum acceptable 3'-terminal annealing score between two primers in tests of primer-primer complementarity. This score is used in tests of primer secondary structure and primer dimer formation. The default maximum acceptable 3'-terminal annealing score is 8.0. Set this to a higher value if you want to relax this constraint

-ENDWGTPrimer=2.0

sets the relative contribution of the 3'-terminal annealing score between two primers in determining the output order of primers and PCR primer pairs.

-ALLANNEALPrimer=14.0

sets the maximum acceptable annealing score over the entire lengths of two primers in tests of primer-primer complementarity. This score is used in tests of primer secondary structure and primer dimer formation. The default maximum acceptable annealing score over the entire lengths of two primers is 14.0. Set this to a higher value if you want to relax this constraint.

-ALLWGTPrimer=1.0

sets the relative contribution of the annealing score over the entire lengths of two primers in determining the output order of primers and PCR primer pairs.

-GCMINPROduct=40.0

sets the minimum acceptable % G+C for amplified PCR products.

-GCMAXPROduct=55.0

sets the maximum acceptable % G+C for amplified PCR products.

-TMMINPROduct=50.0

sets the minimum acceptable melting temperature (in degrees Celsius) for amplified PCR products.

-TMMAXPROduct=65.0

sets the maximum acceptable melting temperature (in degrees Celsius) for amplified PCR products.

-TMDIFference=2.0

sets the maximum acceptable difference between the melting temperatures of the two primers in a PCR amplification experiment.

-ENDANNEALTemplate=16.0

sets the maximum acceptable annealing score between the 3' end of the primer and possible false priming sites on the template sequence. Any repeated sequences you specify with the -REPeats command-line qualifier also are checked for false priming sites. By default, Prima does not determine the annealing score between the 3' end of the primer and possible false priming sites on the template and repeated sequences. If you specify -ENDANNEALTemplate on the command line without any value, then a value of 16.0 is used. Set this to a higher value if you want to relax this constraint.

-ENDWGTTemplate=0.5

sets the relative contribution of the annealing score between the 3' end of the primer and possible false priming sites on the template and repeated sequences in determining the output order of PCR primer pairs.

-ALLANNEALTemplate=28.0

sets the maximum acceptable annealing score between the entire primer and possible false priming sites on the template sequence. Any repeated sequences you specify with the -REPeats command-line qualifier also are checked for false priming sites. By default, Prima does not determine the annealing score between the entire primer and possible false priming sites on the template and repeated sequences. If you specify -ALLANNEALTemplate on the command-line without any value, then a value of 28.0 is used. Set this to a higher value if you want to relax this constraint.

-ALLWGTTemplate=0.25

sets the relative contribution of the annealing score between the entire primer sequence and possible false priming sites on the template and repeated sequences in determining the output order of PCR primer pairs.

-MONitor

This program normally monitors its progress on your screen. However, when you use the -Default option to suppress all program interaction, you also suppress the monitor. You can turn it back on with this option. If your program is running in batch, the monitor will appear in the log file. If the monitor is slowing the program down, suppress it with -NOMONitor.

-SUMmary

writes a summary of the program's work to the screen when you've used the -Default qualifier to suppress all program interaction. A summary typically displays at the end of a program run interactively. You can suppress the summary for a program run interactively with -NOSUMmary.

Use this qualifier also to include a summary of the program's work in the log file for a program run in batch.

-BATch

submits the program to the batch queue for processing after prompting you for all required user inputs. Any information that would normally appear on the screen while the program is running is written into a log file. Whether that log file is deleted, printed, or saved to your current directory depends on how your system manager has set up the command that submits this program to the batch queue. All output files are written to your current directory, unless you direct the output to another directory when you specify the output file.

When Prima is run in batch using -BATch, instructions for plotting the primer sites are written to a figure file named prima.figure unless the plot has been directed to a specific file or grahpics device from the command line, or has been suppressed with the -NOPLOt command-line option.

-NOPLOt

suppresses the plot of primer site locations.

-DENsity=1000

sets the number of bases or amino acids per 100 platen units (PU). This is usually equivalent to the number of bases or amino acids per page. Output from different GCG graphics programs that are run at the same density can be compared by lining up the plots on a light box.

-SPAcing=1.6

sets the spacing between each line of the display to 1.6 platen units. If the plot seems crowded on your plotter, try setting the spacing to 3.0.

These options apply to all GCG graphics programs. These and many others are described in detail in Chapter 5, Using Graphics of the User's Guide.

-FIGure=programname.figure

writes the plot as a text file of plotting instructions suitable for input to the Figure program instead of drawing the plot on your plotter.

-FONT=3

draws all text characters on the plot using Font 3 (see Appendix I) .

-COLor=1

draws the entire plot with the pen in stall 1.

These options let you expand or reduce the plot (zoom), move it in either direction (pan), or rotate it 90 degrees (rotate).

-SCAle=1.2

expands the plot by 20 percent by resetting the scaling factor (normally 1.0) to 1.2 (zoom in). You can expand the axes independently with -XSCAle and -YSCAle. Numbers less than 1.0 contract the plot (zoom out).

-XPAN=30.0

moves the plot to the right by 30 platen units (pan right).

-YPAN=30.0

moves the plot up by 30 platen units (pan up).

-PORtrait

rotates the plot 90 degrees. Usually, plots are displayed with the horizontal axis longer than the vertical (landscape). Note that plots are reduced or enlarged, depending on the platen size, to fill the page.


REFERENCES

Borer, P.N., Dengler, B., and Tinoco, I., Jr. (1974). "Stability of Ribonucleic Acid and Double-stranded Helices." Journal of Molecular Biology 86, 843-853.

Rychlik, W. and Rhoads, R.E. (1990). "Optimization of the Annealing Temperature for DNA Amplification in vitro." Nucleic Acids Research 18, 6409-6412.

Breslauer, K.J., Frank, R., Blocker, H., and Marky, L.A. (1986). "Predicting DNA Duplex Stability from the Base Sequence." Proceedings of the National Academy of Sciences USA 83, 3746-3750.

Baldino, M., Jr. (1989). "High Resolution In Situ Hybridization Histochemistry." In Methods in Enzymology, (P.M. Conn, ed.), 168, 761-777, Academic Press, San Diego, California, USA.

Hillier, L. and Green, P. (1991). "OSP: A Computer Program for Choosing PCR and DNA Sequencing Primers." PCR Methods and Applications 1, 124-128.

Slightom et al. (1994) Biotechniques, in press.

Printed: April 22, 1996 15:55 (1162)