FUNCTION
EFingerPrint identifies the products of T1 ribonuclease digestion. EFingerPrint is a version of GCG's old FingerPrint with command line control.
DESCRIPTION
EFingerPrint cuts any subrange of a nucleotide sequence at Gs (as if it were digested with T1 ribonuclease) and arranges the fragments in order of their U (or T) content. Within families of U (or T) content, the fragments are arranged by A content and then by C content. EFingerPrint shows how the fragments would be labeled if the original molecule had been labeled with any single alpha-(32)P-triphosphate by creating a table of the labeled nucleotides that would be found from an alkaline hydrolysis of each fragment. The labels, after hydrolysis, remain on the 3' side of the nearest neighbor 5' to every nucleotide of the kind labeled.
AUTHOR
This GCG program was modified by Jaakko Hattula (Tampere University of Technology, Finland) and Peter Rice (E-mail: pmr@sanger.ac.uk Post: Informatics Division, The Sanger Centre, Hinxton Hall, Cambridge, CB10 1RQ, UK).
All EGCG programs are supported by the EGCG Support Team, who can be contacted by E-mail (egcg@embnet.org).
EXAMPLE
To identify the fragments of a fingerprint of zein.seq, do the following:
% efingerprint
EFINGERPRINT uses RNA sequence data
EFINGERPRINT of what sequence ? zein.seq
Start (* 1 *) ? 14
End (* 614 *) ? 250
Reverse (* no *) ?
Would you like identical fragments summed (* Yes *) ?
What should I call the output file (* zein.fing *) ?
%
OUTPUT
EFingerPrint leaves an extra blank line between "families" of U content. Here is some of the output file for the example above:
EFINGERPRINT of: zein.seq check: 9712 from: 14 to: 250
Corn Storage Protein 19.1 cDNA
Pedersen Devereux and Larkins at Purdue. It was sequenced by
Pedersen and Devereux at Smithies' lab at the University of Wisconsin
and at Larkin's lab at Purdue University, Spring 1981.
Checked carefully September 17, 1981.
December 12, 1995 16:00 ..
Labelling with
Seq Pos GTP | ATP | UTP | CTP
CUUCCCUUCUUCCCCCAUACCUCUCACCAG
26 a | u 3c | a 3u 5c | g 2a 5u 8c
AAAAUCCAAUUCUUCUACCCUACAG
32 g a | 4a 2u 2c | 2a 2u 3c | 2a 3u 3c
/////////////////////////////////////////////////////////////////////////
In the output file, the positions (Pos) indicate the order of T1 ribonuclease fragments in the input sequence. The 5'-terminal fragment is 1 and, in this example, the fragment at the 3' end of the sequence range is 39.
RESTRICTIONS
Unknown.
SEQUENCE TYPE
EFingerprint only accepts nucleotide sequences. If EFingerprint rejects your nucleotide sequence, turn to Appendix VI to see how to change or set the type of a sequence.
COMMAND-LINE SUMMARY
All parameters for this program may be put on the command line. Use the option -CHEck to see the summary below and to have a chance to add things to the command line before the program executes. In the summary below, the capitalized letters in the qualifier names are the letters that you must type in order to use the parameter. Square brackets ([ and ]) enclose qualifiers or parameter values that are optional. For more information, see "Using Program Parameters" in Chapter 3, Basic Concepts: Using Programs in the GCG User's Guide.
Minimal Syntax: % fingerprint [-INfile1=]gamma.seq -Default Prompted Parameters: -BEGin=2101 -END=2600 range of interest -NOREVerse strand [-OUTfile1=]gamma.fing output file name Optional Parameters: -NOSUMidentical suppresses summing statistics for identical fragments
LOCAL DATA FILES
None.
OPTIONAL PARAMETERS
The parameters and switches listed below can be set from the command line. For more information, see "Using Program Parameters" in Chapter 3, Basic Concepts: Using Programs in the User's Guide.
-NOSUMidentical
suppresses summing the statistics for identical fragments
Printed: April 22, 1996 15:52 (1162)