FUNCTION
Melt calculates the melting temperature (Tm) and the percent G+C of a nucleic acid sequence using the algorithms described by Breslauer et al. Proc. Natl. Acad. Sci. USA 83, 3746-3750 and Baldino et al. Methods in Enzymol. 168, 761-777.
DESCRIPTION
Melt produces melting temperature and %C + %G profiles. For the melting temperature profile free energy values calculated from nearest neighbour thermodynamics are used (Breslauer et al. Proc. Natl. Acad. Sci. USA, 83:3746-3750, Baldino et al. Methods in Enzymol. 168:761-777).
AUTHOR
This program was written by Rodrigo Lopez S. (E-mail: rodrigol@biotek.uio.no; Post: Biotechnology Centre of Oslo, PO Box 1125 Blindern, N-0317 Oslo 3, Norway).
All EGCG programs are supported by the EGCG Support Team, who can be contacted by E-mail (egcg@embnet.org).
EXAMPLE
Here is a session with Melt that was used with the first 1000 bases of human low density lipoprotein receptor (GenEMBL:hsldlr), using a window of 21 bases, and a shift of one.
% melt
MELT of what nucleotide sequence(s) ? GenEmbl:hsldlr02
What should I call the output file (* hsldlr02.melt *) ?
What window size (* 20 *) ?
What shift increment (* 1 *) ?
What DNA concentration (nM) (* 50.0 *) ?
What salt concentration (mM) (* 50.0 *) ?
Start (* 1 *) ?
End (* 144 *) ? 50
%
OUTPUT
Here is some of the output file:
ID HSLDLR02 standard; DNA; PRI; 144 BP. AC L00336; K02573; DT 23-APR-1990 (Rel. 23, Last updated, Version 1) DT 23-APR-1990 (Rel. 23, Created) DE Human low density lipoprotein receptor gene, exon 2. KW low density lipoprotein receptor; repetitive sequence. . . . Melt of: EM_PR:HSLDLR02 check: 8167 from: 1 to 50 1 TTTCCTCTCTCTCAGTGGGC 20 Tm=59.5 GC%=55.0 2 TTCCTCTCTCTCAGTGGGCG 21 Tm=63.0 GC%=60.0 3 TCCTCTCTCTCAGTGGGCGA 22 Tm=63.6 GC%=60.0 4 CCTCTCTCTCAGTGGGCGAC 23 Tm=62.5 GC%=65.0 5 CTCTCTCTCAGTGGGCGACA 24 Tm=61.7 GC%=60.0 6 TCTCTCTCAGTGGGCGACAG 25 Tm=61.7 GC%=60.0 7 CTCTCTCAGTGGGCGACAGA 26 Tm=61.7 GC%=60.0 8 TCTCTCAGTGGGCGACAGAT 27 Tm=61.0 GC%=55.0 9 CTCTCAGTGGGCGACAGATG 28 Tm=62.0 GC%=60.0 10 TCTCAGTGGGCGACAGATGT 29 Tm=61.9 GC%=55.0 11 CTCAGTGGGCGACAGATGTG 30 Tm=62.9 GC%=60.0 12 TCAGTGGGCGACAGATGTGA 31 Tm=64.0 GC%=55.0 13 CAGTGGGCGACAGATGTGAA 32 Tm=63.3 GC%=55.0 14 AGTGGGCGACAGATGTGAAA 33 Tm=61.7 GC%=50.0 15 GTGGGCGACAGATGTGAAAG 34 Tm=61.7 GC%=55.0 16 TGGGCGACAGATGTGAAAGA 35 Tm=62.8 GC%=50.0 17 GGGCGACAGATGTGAAAGAA 36 Tm=61.2 GC%=50.0 18 GGCGACAGATGTGAAAGAAA 37 Tm=58.9 GC%=45.0 19 GCGACAGATGTGAAAGAAAC 38 Tm=55.9 GC%=45.0 20 CGACAGATGTGAAAGAAACG 39 Tm=56.9 GC%=45.0 21 GACAGATGTGAAAGAAACGA 40 Tm=53.7 GC%=40.0 22 ACAGATGTGAAAGAAACGAG 41 Tm=52.8 GC%=40.0 23 CAGATGTGAAAGAAACGAGT 42 Tm=52.8 GC%=40.0 24 AGATGTGAAAGAAACGAGTT 43 Tm=51.5 GC%=35.0 25 GATGTGAAAGAAACGAGTTC 44 Tm=52.3 GC%=40.0 26 ATGTGAAAGAAACGAGTTCC 45 Tm=54.3 GC%=40.0 27 TGTGAAAGAAACGAGTTCCA 46 Tm=56.9 GC%=40.0 28 GTGAAAGAAACGAGTTCCAG 47 Tm=55.0 GC%=45.0 29 TGAAAGAAACGAGTTCCAGT 48 Tm=55.0 GC%=40.0 30 GAAAGAAACGAGTTCCAGTG 49 Tm=55.0 GC%=45.0 31 AAAGAAACGAGTTCCAGTGC 50 Tm=57.0 GC%=45.0
RELATED PROGRAMS
MeltPlot is a program that produces a graphical representation of the Tm and %CG profiles.
RESTRICTIONS
None
ALGORITHM
Melt uses a running window of specified length on which it calculates the melting temperature and the %CG contents.
CONSIDERATIONS
RNA sequences must be submited to Melt with the -RNA qualifier on the command line. See section on command line parameters.
None
SUGGESTIONS
None
INPUT FILE
The input file for Melt is a GCG formatted nucleic acid sequence.
COMMAND-LINE SUMMARY
All parameters for this program may be put on the command line. Use the option -CHEck to see the summary below and to have a chance to add things to the command line before the program executes. In the summary below, the capitalized letters in the qualifier names are the letters that you must type in order to use the parameter. Square brackets ([ and ]) enclose qualifiers or parameter values that are optional. For more information, see "Using Program Parameters" in Chapter 3, Basic Concepts: Using Programs in the GCG User's Guide.
Minimum syntax: % melt [-INfile=]empri:hsldlr -Default Prompted Parameters: -BEGin=1 -END=1000 the range of interest -WINdow=100 the window length -SHIFT=1 the window shift -DNAConc=50 the DNA concentration (nM) -SALTConc=50 the salt concentration (mM) [-OUTfile=]hsldlr.melt output file Local Data Files: None Optional Parameters: -RNA the sequence is RNA -PRODuct to ask the following: -FORMamide=0.0 the percent formamide -MISMatch=0.0 the percent mismatch allowed -PRODLength=50 the product length (defaults to window size)
LOCAL DATA FILES
None.
OPTIONAL PARAMETERS
The parameters and switches listed below can be set from the command line. For more information, see "Using Program Parameters" in Chapter 3, Basic Concepts: Using Programs in the GCG User's Guide.
-RNA|&
sets the parameters for RNA bases rather than DNA.
-PRODuct
prompts for percent formamide percent of mismatches allowed and product length.
-FORMamide=0.0
specifies the percent formamide to be used in calculations (ignored unless -PRODuct is used).
-MISMatch=0.0
specifies the percent mismatch to be used in calculations (ignored unless -PRODuct is used).
-PRODLength=50
specifies the product length to be used in calculations (ignored unless -PRODuct is used).
REFERENCES
Breslauer, K.J., Frank, R., Blocker, H., and Marky, L.A. (1986). "Predicting DNA Duplex Stability from the Base Sequence." Proceedings of the National Academy of Sciences USA 83, 3746-3750.
Baldino, M., Jr. (1989). "High Resolution In Situ Hybridization Histochemistry." In Methods in Enzymology, (P.M. Conn, ed.), 168, 761-777, Academic Press, San Diego, California, USA.
Printed: April 22, 1996 15:54 (1162)