FUNCTION

StsSearch looks for primer pairs in a set of sequences.

DESCRIPTION

StsSearch compares a list of primer pairs to a set of sequences, and reports any sequences in which both primers are found exactly, and in the correct orientation.

AUTHOR

This program was written by Peter Rice (E-mail: pmr@sanger.ac.uk Post: Informatics Division, The Sanger Centre, Hinxton Hall, Cambridge, CB10 1RQ, UK).

All EGCG programs are supported by the EGCG Support Team, who can be contacted by E-mail (egcg@embnet.org).

EXAMPLE

Here is a sample session with StsSearch. The sts.primers file can be copied to your directory by the command "fetch egenrundata:sts.primers".

% stssearch

 STSSEARCH uses nucleotide sequences

 STSSEARCH of what sequence(s) ?  Em_Sts:Bt*

 What file ? sts.primers

 What should I call the output file (* bt15431.sts *) ?  bt.sts

 What should I call the error file (* bt.err *) ?

  Primers: 4
  Entries: 178
    Bases: 69,751
 CPU Time: 7.460000

%

OUTPUT

The output from StsSearch is a simple report of hits in the sequence. The error file reports near misses, for example where only one primer of a pair hits in a sequence.

EM_STS:BT15433 + 106 RME23f 76 RME23r 181
EM_STS:BT15434 + 94 RME25f 116 RME25r 209

INPUT FILE

The input file for StsSearch contains an optional heading (ending with a line containing ".."), and pairs of sequences, one per line with a name, as in the example below:

Examples for the STSSEARCH program.

Primers taken from two Bos taurus entries in the em_sts division
so they can be searched against em_sts:bt* which at present (mid 1995)
is not too many
  ..

RME23     GTGAGTACAGGCGCTTTCTG     AGAACAAATGTGACACTCACA
RME25     TTAAAGATCCCAGCCTGTGC     AGTGGGTAAAGGAGCCTGGT

COMMAND-LINE SUMMARY

All parameters for this program may be put on the command line. Use the option -CHEck to see the summary below and to have a chance to add things to the command line before the program executes. In the summary below, the capitalized letters in the qualifier names are the letters that you must type in order to use the parameter. Square brackets ([ and ]) enclose qualifiers or parameter values that are optional. For more information, see "Using Program Parameters" in Chapter 3, Basic Concepts: Using Programs in the GCG User's Guide.

Minimum Syntax: % stssearch [-INfile1=]Em_Sts:Hs*
[-INfile2=]sts.primers -Default

Prompted Parameters:

[-OUTfile=]results.sts   Output file
[-ERRfile=]results.err   Error message file

Optional Parameters:

-NOSUMmary            Do not write summary statistics at end of run
-PRIMer1=cagtcgtcgta  Sequence of forward primer
-PRIMer2=ttctagcagta  Sequence of reverse primer
-NAme1=PrimerA        Name of forward primer
-NAme2=PrimerB        Name of reverse primer

OPTIONAL PARAMETERS

The parameters and switches listed below can be set from the command line. For more information, see "Using Program Parameters" in Chapter 3, Basic Concepts: Using Programs in the GCG User's Guide.

-REQopt=0

Description of the option in a few lines

NOSUMmary

Do not write summary statistics at end of run.

PRIMer1=cagtcgtcgta

Sequence of a single forward primer instead of a list file. If used, both primer1 and primer2 must be provided.

PRIMer2=ttctagcagta

Sequence of a single reverse primer instead of a list file. If used, both primer1 and primer2 must be provided.

NAme1=PrimerA

Name of forward primer when these are on the command line.

NAme2=PrimerB

Name of reverse primer when these are on the command line.

Printed: April 22, 1996 15:55 (1162)